<img height="1" width="1" style="display:none" src="https://www.facebook.com/tr?id=348185225613720&amp;ev=PageView&amp;noscript=1">
Oligo_Flex_Corona_LP_US_July23_2020

Around the world, researchers are working tirelessly to characterize and understand the mechanisms of novel coronavirus (2019-nCoV/SARS-CoV-2). Unprecedented global collaboration of scientists and institutions has led to the sequencing of the viral genome, ultimately leading to the development of polymerase chain reaction-based assays for rapid identification of the virus in infected individuals1, 2, 3.

GENEWIZ remains committed to advancing research around the outbreak with our unique solutions. Scientists can now order primers and qPCR probes approved by the Centers for Disease Control and Prevention (CDC), World Health Organization (WHO), and Chinese government for rapid identification of the virus.

HPLC purified COVID-19 primers and qPCR probes are available for direct order through our e-commerce platform.

Please note, all COVID-19 primers and qPCR probes are for Research Use Only (RUO) and not for use in diagnostic procedures. 

How to order

1. Log in to your account at genewiz.com

2. Navigate to Oligo Synthesis → Oligo Flex Services

3. Fill out the form with your oligo needs

4. Click Save and Review to review the details of your order

5. Click Add to Cart and proceed to check out

(you will be asked to complete your profile, if you haven't already done so)

6. Confirm your shipping address and enter payment details

7. Accept the Terms and Conditions and click Check Out

8. Print order receipt if needed

 

ORDER NOW

List of available primers and qPCR probes:

Origin Primer ID Description Sequence (5' - 3') 5' Modification 3' Modification
US CDC 2019-nCoV_N1-F 2019-nCoV_N1 Forward Primer GACCCCAAAATCAGCGAAAT    
2019-nCoV_N1-R 2019-nCoV_N1 Reverse Primer TCTGGTTACTGCCAGTTGAATCTG    
2019-nCoV_N1-P 2019-nCoV_N1 qPCR Probe ACCCCGCATTACGTTTGGTGGACC 5'-FAM 3'-BHQ1
 
2019-nCoV_N2-F 2019-nCoV_N2 Forward Primer TTACAAACATTGGCCGCAAA    
2019-nCoV_N2-R 2019-nCoV_N2 Reverse Primer GCGCGACATTCCGAAGAA    
2019-nCoV_N2-P 2019-nCoV_N2 qPCR Probe ACAATTTGCCCCCAGCGCTTCAG 5'-FAM 3'-BHQ1
 
2019-nCoV_N3-F 2019-nCoV_N3 Forward Primer GGGAGCCTTGAATACACCAAAA    
2019-nCoV_N3-R 2019-nCoV_N3 Reverse Primer TGTAGCACGATTGCAGCATTG    
2019-nCoV_N3-P 2019-nCoV_N3 qPCR Probe AYCACATTGGCACCCGCAATCCTG 5'-FAM 3'-BHQ1
 
RP-F RNAse P Forward Primer AGATTTGGACCTGCGAGCG    
RP-R RNAse P Reverse Primer GAGCGGCTGTCTCCACAAGT    
RP-P RNAse P qPCR Probe TTCTGACCTGAAGGCTCTGCGCG 5'-FAM 3'-BHQ1
 
WHO RdRP_SARSr-F2 RdRP gene GTGARATGGTCATGTGTGGCGG    
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA    

RdRP_SARSr-P2

CAGGTGGAACCTCATCAGGAGATGC 5'-FAM 3'-BHQ1
   
Primer RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG    
Primer RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA    
qPCR Probe RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 5'-FAM 3'-BHQ1
 

E_Sarbeco_F1

E gene ACAGGTACGTTAATAGTTAATAGCGT    
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA    
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 5'-FAM 3'-BHQ1
 
Chinese CDC 2019-nCoV-OFP   CCCTGTGGGTTTTACACTTAA    
2019-nCoV-ORP ORF1ab ACGATTGTGCATCAGCTGA    
2019-nCoV-OP   CCGTCTGCGGTATGTGGAAAGGTTATGG 5'-FAM 3'-BHQ1
 
2019-nCoV-NFP   GGGGAACTTCTCCTGCTAGAAT    
2019-nCoV-NRP Nucleoprotein-protein N CAGACATTTTGCTCTCAAGCTG    
2019-nCoV-NP   TTGCTGCTGCTTGACAGATT 5'-FAM 3'-BHQ1

*W is A/T; R is G/A; M is A/C ; FAM, 6-carboxyfluorescein; BHQ1, blackhole quencher.

 

 

ORDER NOW

 

 

 

References:

  1. US Centers for Disease Control and Prevention. (2020, February 4). Real-time RT-PCR panel for detection 2019-novel coronavirus. https://www.cdc.gov/coronavirus/2019-ncov/downloads/rt-pcr-panel-for-detection-instructions.pdf.
  2. Author Unknown. (2020, January 17). Diagnostic detection of 2019-nCoV by real-time RT-PCR. https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf?sfvrsn=a9ef618c_2.
  3. National Institute For Viral Disease Control and Prevention. (2020, January 21). Specific primers and probes for detection 2019 novel coronavirus. http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html.

Additional information can be found at https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance